Sequence retrieval

Genome: Candidate division WWE3 bacterium RAAC2_WWE3_1
Start position: 592714
End position: 592743
Length: 30

DNA sequence
>NC_023001, from 592714 to 592743 (30 bp); Candidate division WWE3 bacterium RAAC2_WWE3_1 CCGAATAACTCCGAATACCACCTAATAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 592207-593268	Sequence	P147_WWE3C00001G0609 - UDP-glucose 4-epimerase (Protein is coded in complementary strand; from 593268 to 592207)