Sequence retrieval

Genome: Candidate division WWE3 bacterium RAAC2_WWE3_1
Start position: 329931
End position: 329975
Length: 45

DNA sequence
>NC_023001, from 329931 to 329975 (45 bp); Candidate division WWE3 bacterium RAAC2_WWE3_1 CTGCCCCCAAATGCTCCGCCTCCGAATGCTCTGTCCCTGAATGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 327773-330001	Sequence	P147_WWE3C00001G0337 - hypothetical protein (Protein is coded in complementary strand; from 330001 to 327773)