Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 943181
End position: 943216
Length: 36

DNA sequence
>NC_022886, from 943181 to 943216 (36 bp); Helicobacter pylori BM012A ATTTGCGCGATTTTTTGGGCGATTTTTTGCGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 941615-943867	Sequence	U063_0925 - Recombination inhibitory protein MutS2 (Protein is coded in complementary strand; from 943867 to 941615)