Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 836231
End position: 836258
Length: 28

DNA sequence
>NC_022886, from 836231 to 836258 (28 bp); Helicobacter pylori BM012A TCTTTTCTTTTTTCTCTTTTATCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 835175-836743	Sequence	U063_0836 - VirB9 (Protein is coded in complementary strand; from 836743 to 835175)