Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 832850
End position: 832879
Length: 30

DNA sequence
>NC_022886, from 832850 to 832879 (30 bp); Helicobacter pylori BM012A GCTTTTTTTAGCTTCTTCTAACTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 829476-835160	Sequence	U063_0835 - Cag 7 (Protein is coded in complementary strand; from 835160 to 829476)