Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 7670
End position: 7696
Length: 27

DNA sequence
>NC_022886, from 7670 to 7696 (27 bp); Helicobacter pylori BM012A CCCATACCACCCATGCCACCCATATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7649-9289	Sequence	U063_0013 - Heat shock protein 60 family chaperone GroEL (Protein is coded in complementary strand; from 9289 to 7649)