Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 6638
End position: 6664
Length: 27

DNA sequence
>NC_022886, from 6638 to 6664 (27 bp); Helicobacter pylori BM012A TAGTAGTAGTAGTAGTAGTAGTAGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5284-7194	Sequence	U063_0012 - Outer membrane protein HopZ (Protein is coded in complementary strand; from 7194 to 5284)