Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 559134
End position: 559157
Length: 24

DNA sequence
>NC_022886, from 559134 to 559157 (24 bp); Helicobacter pylori BM012A AATGAGAGCATGAGAGAAAGAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 557103-559184	Sequence	U063_0568 - Outer membrane protein HopM (Protein is coded in complementary strand; from 559184 to 557103)