Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 516671
End position: 516697
Length: 27

DNA sequence
>NC_022886, from 516671 to 516697 (27 bp); Helicobacter pylori BM012A TTTTTTTGATTTTTTTTATTTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 515878-517422	Sequence	U063_0528 - hypothetical protein (Protein is coded in complementary strand; from 517422 to 515878)