Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 330172
End position: 330207
Length: 36

DNA sequence
>NC_022886, from 330172 to 330207 (36 bp); Helicobacter pylori BM012A TTGTTTGGCTAATTCTTTAGCTAATTGTTCGGCTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 329723-330328	Sequence	U063_0349 - Orotate phosphoribosyltransferase (Protein is coded in complementary strand; from 330328 to 329723)