Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 235266
End position: 235301
Length: 36

DNA sequence
>NC_022886, from 235266 to 235301 (36 bp); Helicobacter pylori BM012A AGGGCGTGAAAGAGGGCGTGAAAGAGGGCGTGAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 235156-235428	Sequence	U063_0236 - hypothetical protein (Protein is coded in complementary strand; from 235428 to 235156)