Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1575208
End position: 1575237
Length: 30

DNA sequence
>NC_022886, from 1575208 to 1575237 (30 bp); Helicobacter pylori BM012A GCATTTCAATGTATTTTAATGCATTTAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1573920-1575791	Sequence	U063_1540 - ATP-dependent DNA helicase RecG (Protein is coded in complementary strand; from 1575791 to 1573920)