Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1551262
End position: 1551306
Length: 45

DNA sequence
>NC_022886, from 1551262 to 1551306 (45 bp); Helicobacter pylori BM012A CGCTACCATAACTTGCGCTACCATAACTCGCGCTACCATAACTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1549503-1551869	Sequence	U063_1524 - Copper-translocating P-type ATPase (Protein is coded in complementary strand; from 1551869 to 1549503)