Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1471225
End position: 1471260
Length: 36

DNA sequence
>NC_022886, from 1471225 to 1471260 (36 bp); Helicobacter pylori BM012A TCTACTTTTTCAACTGCTTTTTCATCTTTTTTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1470625-1471437	Sequence	U063_1444 - TonB-like protein (Protein is coded in complementary strand; from 1471437 to 1470625)