Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1438926
End position: 1438952
Length: 27

DNA sequence
>NC_022886, from 1438926 to 1438952 (27 bp); Helicobacter pylori BM012A TTTTCTAAATTTTCTAAGGTTTCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1438830-1440656	Sequence	U063_1416 - Phosphogluconate dehydratase (Protein is coded in complementary strand; from 1440656 to 1438830)