Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1132939
End position: 1132986
Length: 48

DNA sequence
>NC_022886, from 1132939 to 1132986 (48 bp); Helicobacter pylori BM012A GAATATTTTTAGGAATATTTTCAATGATATTTTTAGGAATGTTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1132181-1133020	Sequence	U063_1107 - Ubiquitin-protein ligase (Protein is coded in complementary strand; from 1133020 to 1132181)