Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1121230
End position: 1121265
Length: 36

DNA sequence
>NC_022886, from 1121230 to 1121265 (36 bp); Helicobacter pylori BM012A TTTAATTCTGTGTTTAATTCTGTGTTTAATTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1120468-1121736	Sequence	U063_1094 - Type I restriction-modification system, specificity subunit S (Protein is coded in complementary strand; from 1121736 to 1120468)