Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1098904
End position: 1098927
Length: 24

DNA sequence
>NC_022886, from 1098904 to 1098927 (24 bp); Helicobacter pylori BM012A AACAAAAACAACAAAAAAAACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1098238-1098975	Sequence	U063_1076 - hypothetical protein (Protein is coded in complementary strand; from 1098975 to 1098238)