Sequence retrieval

Genome: Helicobacter pylori BM012A
Start position: 1056299
End position: 1056322
Length: 24

DNA sequence
>NC_022886, from 1056299 to 1056322 (24 bp); Helicobacter pylori BM012A AGCGAGAGAGAGAGAGAGAGAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1054389-1056341	Sequence	U063_1028 - Outer membrane protein HopP (SapA) (Protein is coded in complementary strand; from 1056341 to 1054389)