Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 813327
End position: 813350
Length: 24

DNA sequence
>NC_022807, from 813327 to 813350 (24 bp); Mycoplasma hyorhinis DBS 1050 TCAGGTTCAGGAGCAGGTTCTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 811140-813695	Sequence	Q453_0770 - hypothetical protein (Protein is coded in complementary strand; from 813695 to 811140)