Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 784509
End position: 784532
Length: 24

DNA sequence
>NC_022807, from 784509 to 784532 (24 bp); Mycoplasma hyorhinis DBS 1050 TTTCAAAATTTCTAAATTTCATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 784436-784579	Sequence	Q453_0745 - hypothetical protein (Protein is coded in complementary strand; from 784579 to 784436)