Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 780621
End position: 780645
Length: 25

DNA sequence
>NC_022807, from 780621 to 780645 (25 bp); Mycoplasma hyorhinis DBS 1050 AAAGTGAAGTAAAGAAAATTAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 780458-781513	Sequence	Q453_0743 - oligopeptide transporter permease (Protein is coded in complementary strand; from 781513 to 780458)