Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 777995
End position: 778018
Length: 24

DNA sequence
>NC_022807, from 777995 to 778018 (24 bp); Mycoplasma hyorhinis DBS 1050 ATTTTGTTTTTTTGTTAATTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 775944-778247	Sequence	Q453_0740 - ABC transporter family protein (Protein is coded in complementary strand; from 778247 to 775944)