Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 760863
End position: 760886
Length: 24

DNA sequence
>NC_022807, from 760863 to 760886 (24 bp); Mycoplasma hyorhinis DBS 1050 AAACAAAAACTAAAACAAAAACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 759513-760976	Sequence	Q453_0723 tig Bacterial trigger factor protein TF