Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 707796
End position: 707825
Length: 30

DNA sequence
>NC_022807, from 707796 to 707825 (30 bp); Mycoplasma hyorhinis DBS 1050 CTTCATTTTTCTTCTTTTTCCTTTAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 707527-707802	Sequence	Q453_0668 - N-acetylmannosamine kinase, ROK family protein (Protein is coded in complementary strand; from 707802 to 707527)