Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 694821
End position: 694850
Length: 30

DNA sequence
>NC_022807, from 694821 to 694850 (30 bp); Mycoplasma hyorhinis DBS 1050 AAAAAAAGAAAAATAAAAGAAGAAAAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 694766-695233	Sequence	Q453_0656 - hypothetical protein (Protein is coded in complementary strand; from 695233 to 694766)