Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 667874
End position: 667903
Length: 30

DNA sequence
>NC_022807, from 667874 to 667903 (30 bp); Mycoplasma hyorhinis DBS 1050 TATTTTCCTTTATTTTAATTAATTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 667021-667875	Sequence	Q453_0628 ylqF ribosome biogenesis GTP-binding protein YlqF (Protein is coded in complementary strand; from 667875 to 667021)
ORF... 667893-669227	Sequence	Q453_0629 mnuA Membrane nuclease, lipoprotein (Protein is coded in complementary strand; from 669227 to 667893)