Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 572285
End position: 572308
Length: 24

DNA sequence
>NC_022807, from 572285 to 572308 (24 bp); Mycoplasma hyorhinis DBS 1050 ATTTTAATTTAAATTTCATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 570580-572304	Sequence	Q453_0528 - putative lipoprotein (Protein is coded in complementary strand; from 572304 to 570580)
ORF... 572294-573121	Sequence	Q453_0529 potC ABC transporter permease (Protein is coded in complementary strand; from 573121 to 572294)