Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 562412
End position: 562436
Length: 25

DNA sequence
>NC_022807, from 562412 to 562436 (25 bp); Mycoplasma hyorhinis DBS 1050 TAAATTTAATTGAATTGAATTGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 561993-562463	Sequence	Q453_0519 ulaC ascorbate-specific phosphotransferase enzyme IIA component (Protein is coded in complementary strand; from 562463 to 561993)