Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 459627
End position: 459659
Length: 33

DNA sequence
>NC_022807, from 459627 to 459659 (33 bp); Mycoplasma hyorhinis DBS 1050 CTTTTGTAAATCTTTTAAAAATCTTTTCTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 459389-459925	Sequence	Q453_0399 atpH ATP synthase F1, delta subunit (Protein is coded in complementary strand; from 459925 to 459389)