Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 367147
End position: 367182
Length: 36

DNA sequence
>NC_022807, from 367147 to 367182 (36 bp); Mycoplasma hyorhinis DBS 1050 TTTTAAAATCTACTTTAAAATCTTTTTTATTATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 365094-370610	Sequence	Q453_0318 - GDSL-like Lipase/Acylhydrolase family protein (Protein is coded in complementary strand; from 370610 to 365094)