Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 337373
End position: 337396
Length: 24

DNA sequence
>NC_022807, from 337373 to 337396 (24 bp); Mycoplasma hyorhinis DBS 1050 CTGTTTCTGTATCTGTATCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 332155-340278	Sequence	Q453_0291 - ABC transporter permease (Protein is coded in complementary strand; from 340278 to 332155)