Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 325377
End position: 325401
Length: 25

DNA sequence
>NC_022807, from 325377 to 325401 (25 bp); Mycoplasma hyorhinis DBS 1050 TTTTTTTTCTTTCTTATTTTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 324713-325378	Sequence	Q453_0281 - chromate transporter family protein (Protein is coded in complementary strand; from 325378 to 324713)
ORF. 325356-325949	Sequence	Q453_0282 - chromate transporter family protein (Protein is coded in complementary strand; from 325949 to 325356)