Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 301142
End position: 301165
Length: 24

DNA sequence
>NC_022807, from 301142 to 301165 (24 bp); Mycoplasma hyorhinis DBS 1050 AATATTATTATTATTATTAATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 301159-302160	Sequence	Q453_0254 gpsA Glycerol-3-phosphate dehydrogenase (Protein is coded in complementary strand; from 302160 to 301159)