Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 254219
End position: 254242
Length: 24

DNA sequence
>NC_022807, from 254219 to 254242 (24 bp); Mycoplasma hyorhinis DBS 1050 TCTTGCTATTGCTCTTCCTATTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 253590-254834	Sequence	Q453_0219 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 254834 to 253590)