Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 236812
End position: 236841
Length: 30

DNA sequence
>NC_022807, from 236812 to 236841 (30 bp); Mycoplasma hyorhinis DBS 1050 TTCTTCTTTTTTGTTCATTTTTCTCCTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 236447-236830	Sequence	Q453_0203 - putative type III restriction-modification system methylase (Protein is coded in complementary strand; from 236830 to 236447)