Sequence retrieval

Genome: Mycoplasma hyorhinis DBS 1050
Start position: 149086
End position: 149109
Length: 24

DNA sequence
>NC_022807, from 149086 to 149109 (24 bp); Mycoplasma hyorhinis DBS 1050 TAATTTTTTAGTTTTTTAATTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 149080-150765	Sequence	Q453_0141 uvrC Excinuclease ABC subunit C (Protein is coded in complementary strand; from 150765 to 149080)