Sequence retrieval

Genome: Exiguobacterium sp. MH3
Start position: 2852055
End position: 2852081
Length: 27

DNA sequence
>NC_022794, from 2852055 to 2852081 (27 bp); Exiguobacterium sp. MH3 CATTCCGCCCATTCCACCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2852050-2853690	Sequence	U719_15065 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 2853690 to 2852050)