Sequence retrieval

Genome: Exiguobacterium sp. MH3
Start position: 267228
End position: 267263
Length: 36

DNA sequence
>NC_022794, from 267228 to 267263 (36 bp); Exiguobacterium sp. MH3 ATCTCCGTGATCATCCCCGTCATCGTCTCCATGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 267211-268230	Sequence	U719_01480 - hypothetical protein (Protein is coded in complementary strand; from 268230 to 267211)