Sequence retrieval

Genome: Exiguobacterium sp. MH3
Start position: 1834734
End position: 1834778
Length: 45

DNA sequence
>NC_022794, from 1834734 to 1834778 (45 bp); Exiguobacterium sp. MH3 GTCGGTTCGTCCGTTGTCGGTTCGTCCGTTGTCGGTTCGTCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1834467-1837103	Sequence	U719_10055 - penicillin-binding protein (Protein is coded in complementary strand; from 1837103 to 1834467)