Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 978114
End position: 978140
Length: 27

DNA sequence
>NC_022785, from 978114 to 978140 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCTTCGGGTCCTTCGCGTCCTTCGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 977633-978196	Sequence	M271_04095 - hypothetical protein (Protein is coded in complementary strand; from 978196 to 977633)