Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9557028
End position: 9557051
Length: 24

DNA sequence
>NC_022785, from 9557028 to 9557051 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCCGACCCTCCGACCCCCCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9556859-9557251	Sequence	M271_39090 - hypothetical protein (Protein is coded in complementary strand; from 9557251 to 9556859)