Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9325575
End position: 9325598
Length: 24

DNA sequence
>NC_022785, from 9325575 to 9325598 (24 bp); Streptomyces rapamycinicus NRRL 5491 TGCCCCTGCCCCTGACCCTGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9325428-9326186	Sequence	M271_38135 - hypothetical protein (Protein is coded in complementary strand; from 9326186 to 9325428)