Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9325465
End position: 9325518
Length: 54

DNA sequence
>NC_022785, from 9325465 to 9325518 (54 bp); Streptomyces rapamycinicus NRRL 5491 CGCCGCCGTAGCCGTTTCCGCCGCCATAGCCGTTGCCACCGCCGTGGCCGTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9325428-9326186	Sequence	M271_38135 - hypothetical protein (Protein is coded in complementary strand; from 9326186 to 9325428)