Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9320513
End position: 9320536
Length: 24

DNA sequence
>NC_022785, from 9320513 to 9320536 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCACCGGCTCCGGCACCGGCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9319765-9320787	Sequence	M271_38100 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 9320787 to 9319765)