Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9282621
End position: 9282677
Length: 57

DNA sequence
>NC_022785, from 9282621 to 9282677 (57 bp); Streptomyces rapamycinicus NRRL 5491 TGATCAGGGCTCCGCTTGGAGATCCGGGCTCCGCTCGGGGATCGGGGCTCCGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 9281953-9282624	Sequence	M271_37960 - TetR family transcriptional regulator