Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9281774
End position: 9281821
Length: 48

DNA sequence
>NC_022785, from 9281774 to 9281821 (48 bp); Streptomyces rapamycinicus NRRL 5491 CTGACGTGCTGGCTGACGTGCTGACTGCCGTGCTGGCTGCCGTGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9280433-9281866	Sequence	M271_37955 - homogentisate 1,2-dioxygenase (Protein is coded in complementary strand; from 9281866 to 9280433)