Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9273965
End position: 9273988
Length: 24

DNA sequence
>NC_022785, from 9273965 to 9273988 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGCGCCGGCGCACCGGCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9272700-9274214	Sequence	M271_37925 - nickel transporter (Protein is coded in complementary strand; from 9274214 to 9272700)