Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 926210
End position: 926269
Length: 60

DNA sequence
>NC_022785, from 926210 to 926269 (60 bp); Streptomyces rapamycinicus NRRL 5491 CCGGGTCCGCCGCCTCCCGGTCCGCGGTCTCCGGGTCCACCGCCTCCCGGTCCGCCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 926086-926307	Sequence	M271_03875 - hypothetical protein (Protein is coded in complementary strand; from 926307 to 926086)