Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 9240870
End position: 9240899
Length: 30

DNA sequence
>NC_022785, from 9240870 to 9240899 (30 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCGCCCGCCGTGGCCCGGCGCCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9239853-9240941	Sequence	M271_37825 - LacI family transcriptional regulator (Protein is coded in complementary strand; from 9240941 to 9239853)